Precision Biosciences, Inc. · NASDAQ:DTIL
Precision Biosciences — Investor Presentation (November 2019)
45 slides from Precision Biosciences's investor presentation, Nov 13, 2019
Slide 1: Precision BioSciences
PRECISION BIOSCIENCES Cs Dedicated to Improving Life. Cure genetic disease. Feed the planet.
Slide 2: Forward Looking Statement
Forward Looking Statement This presentation (together with any other statements or information that we may make in connection herewith) may contain forward-looking statements. All statements other than statements of present and historical facts contained in this prospectus, including without limitat
Slide 3: Dedicated To Improving Life
Dedicated To Improving Life Overcome Cancer. Cure Genetic Disease. Feed the Planet. 3
Slide 4: Delivering on the Promise of Genome Editing to Address Core Challenges of Human Health
Delivering on the Promise of Genome Editing to Address Core Challenges of Human Health Scaled and cell Proprietary ARCUS phenotype-optimized allogeneic CAR T genome editing platform built for translation with full platform freedom to operate in the clinic for R/R NHL and ALL. Second program entering
Slide 5: Our Near-Term Development Strategy
Our Near-Term Development Strategy Indication: Hepatitis B Indication: NHL and ALL Focusing on validated targets Target: cccDNA and Target: CD19 (PBCAR0191) integrated DNA Clinical Phase 1/2a Building out fully scaled IND 2020 Initial data to be presented in-house manufacturing at ASH 2019 Leveragin
Slide 6: ARCUS
ARCUS Nature’s Genome Editing System 6
Slide 7: Our Objective: Therapeutic-Grade Genome Editing
Our Objective: Therapeutic-Grade Genome Editing Industry’s Approach to Precision BioSciences' Approach Genome Editing to Genome Editing Ease of design ü Safety Speed of manufacture ü Delivery Density of targeting ü Control of edits Open source ü Proprietary 7
Slide 8: ARCUS: Engineering Nature's Genome Editing System
ARCUS: Engineering Nature’s Genome Editing System ARCUS is derived from I-CreI, a homing Genome Editing by I-CreI endonuclease naturally evolved for highly precise genome editing 23S Gene I-CreI binds to Four Key Attributes it’s target site in the genome I-CreI 1. Safety: Self-inactivates to prevent
Slide 9: Overcoming Cancer
Overcoming Cancer Off-the-shelf CAR T 9
Slide 10: Off-the-shelf CAR T Immunotherapy Pipeline
Off-the-shelf CAR T Immunotherapy Pipeline Product Candidates Program Area Discovery Pre-clinical Clinical Rights PBCAR0191 (CD19) NHL and ALL - Ph1/2a initiated Q2 2019, Initial Data at ASH 2019 PBCAR20A (CD20) NHL, CLL, SLL - IND accepted, Ph1/2a start Q4 2019 PBCAR269A (BCMA) MM - IND 2020 PBCAR3
Slide 11: Unique Approach to Allogeneic CAR T Positions for Potential Best-in-Class Product Profile
Unique Approach to Allogeneic CAR T Positions for Potential Best-in-Class Product Profile Optimized cell phenotype • Rigorous donor selection • TN/SCM & TCM • Maximize in vivo expansion Op ti cess ype m i m al ro ot lde ph ing p hen r ly eno r p mp typ fa ctu imal ho e p nu opt de er ple mi Ma rves
Slide 12: PBCAR0191 (CD19): Phase 1/2a Clinical Plan
PBCAR0191 (CD19): Phase 1/2a Clinical Plan Safety Assessment Screening Treatment Period Follow-Up LTFU Study Day -14 -7 -5 -4 -3 0 28 60 90 180 360 PBCAR0191 Safety & Response End of Study Enrollment Infusion x1 Assessment Lymphodepletion Fludarabine 90 mg/m2 + Cyclophosphamide 1500 mg/m2 First pati
Slide 13: ASH 2019 Abstract - Initial Clinical Data Supporting Safety and Clinical Activity of PBCAR0191
ASH 2019 Abstract - Initial Clinical Data Supporting Safety and Clinical Activity of PBCAR0191 Abstract dataset Key initial findings • 3 patients treated at DL1 (3x105/kg) 1 Safety • Advanced NHL (1 patient MCL, 2 patients DLBCL) • No serious adverse events or DLTs observed over • August 1st, 2019 d
Slide 14: PBCAR20A (CD20): Phase 1/2a Clinical Plan
PBCAR20A (CD20): Phase 1/2a Clinical Plan Safety Assessment Screening Treatment Period Follow-Up LTFU Study Day -14 -7 -5 -4 -3 0 28 60 90 180 360 PBCAR20A Safety & Response End of Study Enrollment Infusion x1 Assessment Lymphodepletion Fludarabine 90 mg/m2 + Cyclophosphamide 1500 mg/m2 Ph 1/2a expe
Slide 15: PBCAR269A (BCMA): Phase 1/2a Clinical Plan
PBCAR269A (BCMA): Phase 1/2a Clinical Plan Safety Assessment Screening Treatment Period Follow-Up LTFU Study Day -14 -7 -5 -4 -3 0 28 60 90 180 360 PBCAR269A Safety & Response End of Study Enrollment Infusion x1 Assessment Lymphodepletion Fludarabine 90 mg/m2 + Cyclophosphamide 1500 mg/m2 Eligibilit
Slide 16: Precision BioSciences' Proprietary Single Step CAR T Process
Precision BioSciences’ Proprietary Single Step CAR T Process Single-step CAR T • Reduces heterogeneity in cell formulation Exon 1 Endogenous TCR CAR knocked • Streamlines manufacturing disrupted by ARCUS IN cutting at Exon 1 at targeted locus • Claimed in 9 issued US patents AAV CAR ARCUS 16
Slide 17: Novel Costimulatory Domain Preserves Cell Phenotype
Novel Costimulatory Domain Preserves Cell Phenotype • Precision CARs incorporate a novel N6 maintains a greater percentage of naïve cells proprietary costimulatory domain called “N6” • N6 preserves naïve phenotype and expansion potential • N6 promotes cell expansion while maintaining better than CD2
Slide 18: Scaled CAR T Manufacturing: Optimizes Yield and Quality
Scaled CAR T Manufacturing: Optimizes Yield and Quality Data from three GMP batches of PBCAR0191 clinical material (Dec 2018-Jan 2019) 30B 25B ARCUS Cell Number mRNA Final Yield 20B + CD19 Drug Product (64M CAR T cells/vial) Vial Count 15B CAR AAV Healthy Batch donor draw 1 130 10B 2 114 3 100 isola
Slide 19: CAR T Cell Phenotype Optimized for In Vivo Expansion
CAR T Cell Phenotype Optimized for In Vivo Expansion PBCAR0191 has a high proportion of Naïve and Central Memory CAR T Naïve and Central Memory CAR T cells. cells are understood to be responsible for robust 40 CD4 : CD8 ratio 1.25 : 1 in vivo CAR T expansion % CAR+ Cells • Donor selection and propri
Slide 20: First In-House cGMP Manufacturing Facility for Genome Edited Allogeneic CAR T in the U.S.
First In-House cGMP Manufacturing Facility for Genome Edited Allogeneic CAR T in the U.S. • Precision’s Manufacturing Center for Advanced Therapeutics (MCAT) is a 17,300 square foot cGMP clinical manufacturing facility • Allogeneic CAR T Cells, mRNA (10g scale) and rAAV (400L scale) vectors for in-v
Slide 21: Curing Genetic Disease
Curing Genetic Disease In Vivo Gene Correction 21
Slide 22: In Vivo Gene Correction Pipeline
In Vivo Gene Correction Pipeline Product Candidate Program Area Discovery Pre-clinical Clinical Rights HBV Chronic Hepatitis B – IND 2020 Transthyretin Familial amyloid polyneuropathy HAO1 Primary hyperoxaluria FVIII (Intron 22 inversion) Hemophilia A Candidate selection for lead gene correction (2H
Slide 23: An In Vivo Gene Correction Platform to Cure Genetic Disease
An In Vivo Gene Correction Platform to Cure Genetic Disease In vivo gene corrections are permanent and require a therapeutic-grade genome editing approach 3 Key Parameters Precision BioSciences’ Approach Result • Self-inactivating system Safety • Protein/DNA interaction • Elimination of random off-t
Slide 24: Precision's In Vivo Gene Correction Strategy
Precision’s In Vivo Gene Correction Strategy 24
Slide 25: Hepatitis B: Targeted Elimination of Virus DNA
Hepatitis B: Targeted Elimination of Virus DNA ARCUS can target and destroy HBV cccDNA Development of a potential cure A) ARCUS reduces HBV S-antigen We are working with Gilead to in infected human hepatocytes develop a drug formulation for 100 curing chronic HBV infection 80 • mRNA-based drug 60 •
Slide 26: Familial Hypercholesterolemia: Reduce 'Bad' Cholesterol
Familial Hypercholesterolemia: Reduce ‘Bad’ Cholesterol Rhesus macaques treated with ARCUS show reductions in PCSK9 and LDL levels, sustained since 2017 • First peer-reviewed data demonstrating in vivo gene correction in a non-human primate model • Animals tolerated treatment, no obvious AEs and app
Slide 27: Autosomal Dominant Retinitis Pigmentosa: Restore Vision
Autosomal Dominant Retinitis Pigmentosa: Restore Vision ARCUS can be used to selectively eliminate the AAV5 Electroretinogram (ERG) P23H RHO gene associated with adRP ARCUS-P23H >wild-type rhodopsin leave WT allele intact ACGGGTGTGGTACGCAGCCCCT Inject P3-P7 (one eye) >RHO C68A (P23H) mutant eliminat
Slide 28: Feed the Planet
Feed the Planet Elo Life Systems 28
Slide 29: Food Pipeline
Food Pipeline Product Discovery Greenhouse Field Program Lead Ultra-low Saturate Canola Oil Scaled, Zero Calorie Watermelon Sweetener Self-Breeding Stevia High Protein Chickpea 29
Slide 30: A Food Editing Platform Built to Deliver Healthy Nutrition
A Food Editing Platform Built to Deliver Healthy Nutrition Elo Life Systems, a subsidiary of Precision BioSciences, seeks to improve human health through food 3 Key Parameters Elo Life Systems’ Approach Result • Cross-species information transfer Data • Multi-omic target discovery • Rapid response t
Slide 31: Ultra-Low Saturate Canola Oil
Ultra-Low Saturate Canola Oil Cargill is one of the world’s largest producers of cooking oil. We are collaborating with Cargill to develop ultra-low saturate “heart healthy” canola oil Goal: Decrease saturated fatty acids in canola oil through 100 metabolic engineering Reduction 26% 20% in TSFA % To
Slide 32: Mogroside V: Scaled Zero Calorie Sweetener
Mogroside V: Scaled Zero Calorie Sweetener Mogroside V is an all-natural zero calorie sweetener from Monk Fruit + ARCUS Mogroside V is difficult to source because monk fruit is not scalable Mogroside V pathway activity ü û ü • Grown regionally, long life cycle, small, difficult to cultivate and proc
Slide 33: Significant Near-Term Value Catalysts Expected Through 2019 into 2020
Significant Near-Term Value Catalysts Expected Through 2019 into 2020 ü Initial Public Offering (Ticker: DTIL) - Q2 2019 ü Clinical dosing of allogeneic CD19 CAR T - Q2 2019 ü Open cGMP manufacturing facility: CAR T, mRNA, AAV – Q3 2019 ü IND acceptance and ODD for wholly owned CD20 CAR T CD20 CAR T
Slide 34: Key Takeaways
Key Takeaways Highly experienced team of over 180 Precisioneers includes the pioneers in editing Proprietary ARCUS genome editing platform with full freedom to operate Independent cGMP manufacturing capabilities by YE 2019 Multiple allogeneic CAR T programs expected to be in clinical trials by YE 20
Slide 35: Dedicated To Improving Life
Dedicated To Improving Life 35
Slide 36: ARCUS Intellectual Property
ARCUS Intellectual Property • Precision controls more than 50 issued US and foreign patents related to the ARCUS platform and ARCUS nuclease products • Two core US patents (‘867 & ‘015) have undergone reexamination and were confirmed with no changes • Each new ARCUS nuclease that generates a novel m
Slide 37: ARCUS: Engineered I-CreI Nucleases
ARCUS: Engineered I-CreI Nucleases • ARCUS platform – an iterative protein engineering process involving changes to the specificity, affinity, and cleavage efficiency of I-CreI 37
Slide 38: Highly Sensitive Off-Target Detection
Highly Sensitive Off-Target Detection 1st Generation Unbiased Off-Target Analysis ARCUS Step 1: Transfect cells with first generation ARCUS and a DNA ARCUS “tag” Optimization Step 2: Tag captured at Clinical double stranded breaks Candidate resulting from ARCUS cleavage Optimized clinical candidate
Slide 39: I-CreI: A Natural Genome Editing Enzyme
I-CreI: A Natural Genome Editing Enzyme • ARCUS is derived from I-CreI, a genome editing “homing” endonuclease (HE) from the algae Chlamydomonas reinhardtii – Intron-encoded enzyme in the 23S ribosomal RNA gene • Member of the LAGLIDADG homing endonuclease family and among the best biochemically und
Slide 40: Example: Creating an ARCUS Nuclease from I-CreI
Example: Creating an ARCUS Nuclease from I-CreI Goal: Create an ARCUS nuclease to knockout the PCSK9 gene while retaining desirable attributes of I-CreI I-CreI ARC-PCSK9 Alter the amino acids at these positions so the nuclease now specifically Amino acids binds to PCSK9 gene responsible for recogniz
Slide 41: ARCUS: Engineered I-CreI Endonucleases
ARCUS: Engineered I-CreI Endonucleases Linker CAAAACGTCGTGAGACAGTTTG TGGACCTCTTTGCCCCAGGGGA wild-type I-CreI target site in Chlamydomonas M1PCSK9 target site in human PCSK9 Exon 7 41
Slide 42: ARCUS Example: PCSK9
ARCUS Example: PCSK9 As reported in Wang, et al (2018, Nat. Biotech 36:717-725) an ARCUS nuclease was developed to knockout the human/non-human primate PCSK9 gene. Three generations of the nuclease were produced and tested in non-human primates. Each generation had amino acid substitutions aimed at
Slide 43: ARCUS Example: PCSK9
ARCUS Example: PCSK9 Three generations of a PCSK9 ARCUS nuclease were assayed for off-target editing in human cells and NHP liver biopsies using an advanced method called “Oligo Capture” followed by deep sequencing. It was found that each successive generation had significant reductions in off-targe
Slide 44: PBCAR0191 Dose Level 1 in Context – Autologous CAR T Response Rates at Low Doses
PBCAR0191 Dose Level 1 in Context – Autologous CAR T Response Rates at Low Doses Yescarta Kymriah Turtle et al. CD19 NHL 2x106/kg 0.6-6x106/kg 2x105/kg* 2x106/kg** CR 51% 32% 33% 64% PR 21% 18% 0% 9% Yescarta Kymriah 5x105/kg 1x106/kg 2x106/kg 0.6-6x106/kg B-ALL n=16 n=19 n=6 PBCAR0191 dose levels C
Slide 45: "Stealth Cell" β2M Knockdown to Extend Cell Persistence
“Stealth Cell” β2M Knockdown to Extend Cell Persistence • Completely eliminating MHC-I (knocking out β2M) results in rapid cell killing by NK cells • Reducing surface expression of MHC-I to ~10% of wild-type levels reduces cell lysis by T cells or NK 100 45 100 50 B2M B2M 90 40 90 45 (normalized mea
Precision BioSciences — Investor Presentation (November 2019) on 6ix