Alnylam Pharmaceuticals, Inc. · NASDAQ:ALNY
Alnylam Pharmaceuticals — Investor Presentation (June 2015)
40 slides from Alnylam Pharmaceuticals's investor presentation, June 2015
Slide 1: Corporate Overview
Corporate Overview June 2015 1
Slide 2: Alnylam Forward Looking Statements
Alnylam Forward Looking Statements This presentation contains forward-looking statements, within the meaning of Section 27A of the Securities Act of 1933 and Section 21E of the Securities Exchange Act of 1934. There are a number of important factors that could cause actual results to differ material
Slide 3: RNAi Therapeutics: A New Class of Innovative Medicines
RNAi Therapeutics A New Class of Innovative Medicines • Harness natural pathway ◦ Catalytic mechanism ◦ Mediated by small interfering RNA or “siRNA” • Therapeutic gene silencing ◦ Any gene in genome ◦ Distinct mechanism of action vs. other drug classes ◦ Unique opportunities for innovative medicines
Slide 4: Alnylam RNAi Therapeutics Strategy
Alnylam RNAi Therapeutics Strategy A Reproducible and Modular Path for Innovative Medicines 2. POC achieved in Phase 1 ACAAGAUGCCAUUGUCCCCCGGCCUCC • Blood-based biomarker with strong UGCUGCUGCUGCUCUCCGGGGCCACGG disease correlation CCACCGCUGCCCUGCCCCUGGAGGGUG GCCCCUGGAGGG GCCCCACCGGCCGAGACAGCGAGCAUA
Slide 5: Alnylam Strategic Therapeutic Areas (STAr)
Alnylam Strategic Therapeutic Areas (STAr) Genetic Medicines Cardio-Metabolic Disease Hepatic Infectious Disease • Genetically validated • Genetically validated liver • Liver pathogen and/or liver targets for rare targets for dyslipidemia, host targets orphan diseases NASH, type 2 diabetes, • Sub-ac
Slide 6: Alnylam Development Pipeline
Alnylam Development Pipeline Discovery Development Phase 1 Phase 2 Phase 3 GENETIC MEDICINES Patisiran (ALN-TTR02) TTR-Mediated Amyloidosis Revusiran (ALN-TTRsc) Hemophilia and Rare Bleeding Disorders ALN-AT3 Complement-Mediated Diseases ALN-CC5 Hepatic Porphyrias ALN-AS1 Alpha-1 Antitrypsin Deficie
Slide 7: Alnylam Development Pipeline
Alnylam Development Pipeline Discovery Development Phase 1 Phase 2 Phase 3 GENETIC MEDICINES Patisiran (ALN-TTR02) TTR-Mediated Amyloidosis Revusiran (ALN-TTRsc) Hemophilia and Rare Bleeding Disorders ALN-AT3 Complement-Mediated Diseases ALN-CC5 Hepatic Porphyrias ALN-AS1 Alpha-1 Antitrypsin Deficie
Slide 8: Transthyretin-Mediated Amyloidosis (ATTR) Program
GENETIC MEDICINES Transthyretin-Mediated Amyloidosis (ATTR) Program Unmet Need and Product Opportunity Progressive, debilitating monogenic disease • ATTR is significant orphan disease ◦ ~50,000 Patients worldwide • Clinical pathology ◦ Onset ~40 to >60 yr; fatal within 2-15 years ◦ Two predominant f
Slide 9: RNAi Therapeutics for ATTR Amyloidosis
GENETIC MEDICINES RNAi Therapeutics for ATTR Amyloidosis Patisiran and Revusiran Patisiran for Familial Amyloidotic Revusiran for Familial Amyloidotic Polyneuropathy (FAP) Cardiomyopathy (FAC) • Intravenous administration • Subcutaneous administration • Positive Phase 2 results in FAP • Positive Pha
Slide 10: Patisiran Phase 2 OLE Preliminary Study Results
GENETIC MEDICINES Patisiran Phase 2 OLE Preliminary Study Results* Change in mNIS+7 at 12 Months Evidence that neuropathy progression halted at 12 months • Mean decrease of 2.5 points observed • Compares favorably with 13 to 18 point increase estimated from historical data sets • Similar result in p
Slide 11: Patisiran Phase 2 OLE Preliminary Study Results
GENETIC MEDICINES Patisiran Phase 2 OLE Preliminary Study Results* Change in mNIS+7 at 12 Months Evidence that neuropathy progression halted at 12 months • Mean decrease of 2.5 points observed • Compares favorably with 13 to 18 point increase estimated from historical data sets • Similar result in p
Slide 12: APOLLO Phase 3 Study Design
GENETIC MEDICINES APOLLO Phase 3 Study Design Primary Endpoint • mNIS+7 at 18 months Patient Population • FAP: any Patisiran IV infusion Secondary Endpoints 2:1 RANDOMIZATION TTR mutation, q3W, 0.3 mg/kg • Norfolk QOL-DN Stages 1 and 2 • NIS-weakness • mBMI • 10-meter walk test • Neurological • COMP
Slide 13: Revusiran Phase 2 Study Results
GENETIC MEDICINES Revusiran Phase 2 Study Results Open label, multi-dose study in TTR cardiac amyloidosis patients • Includes patients with FAC and senile systemic amyloidosis (SSA) • Up to 98.2% TTR knockdown with similar effects toward WT and mutant protein • Generally well tolerated ◦ Transient m
Slide 14: ENDEAVOUR Phase 3 Study Design
GENETIC MEDICINES APOLLO Phase 3 Study Design Patient Population • Documented TTR Co-Primary Endpoints mutation, including Revusiran 500mg SC • Change in 6-MWD at 2:1 RANDOMIZATION V122I or other qD x 5, then qW 18 months compared for 18 mos to baseline • Amyloid deposits • Percent reduction in on b
Slide 15: Hemophilia and Rare Bleeding Disorders Program
GENETIC MEDICINES Hemophilia and Rare Bleeding Disorders Program Unmet Need and Product Opportunity High unmet needs in hemophilia and rare bleeding disorders (RBD) • Hemophilias are recessive X-linked monogenic bleeding disorders ◦ Hemophilia A: loss of function in Factor VIII – >40,000 Patients in
Slide 16: Antithrombin and ALN-AT3 Program
GENETIC MEDICINES Antithrombin and ALN-AT3 Program Intrinsic system Extrinsic system Antithrombin (AT) is genetically Hemophilia B defined target FX FVIIa FVII FIX FIX FIXa • AT is key natural anticoagulant ◦ Inactivates Factor Xa and thrombin Hemophilia A ◦ Attenuates thrombin generation FVIII FVII
Slide 17: ALN-AT3 Phase 1 Study Results
GENETIC MEDICINES ALN-AT3 Phase 1 Study Results Potent, dose-dependent, and durable AT knockdown at low microgram/kilogram (mcg/kg) SC doses • Up to 86% AT knockdown and mean maximum AT knockdown of 59 ± 7% (p<0.05); durable, lasting ~60 days Evidence for re-balancing of hemostasis in severe hemophi
Slide 18: ALN-AT3 Phase 1 Exploratory Post Hoc Analysis of Bleeding
GENETIC MEDICINES ALN-AT3 Phase 1 Study Results Exploratory Post Hoc Analysis of Bleeding Reduced ABR associated with increased AT knockdown and thrombin generation • In small number of subjects, ABR=0 at AT knockdown >66% (p <0.001) Maximum bleed-free interval of 114 days in severe hemophilia subje
Slide 19: Complement Disease Program
GENETIC MEDICINES Complement Disease Program Unmet Need and Program Opportunity Wide range of complement-mediated diseases • Excessive complement activity drives disease pathophysiology in many indications ◦ Paroxysmal nocturnal hemoglobinuria (PNH) ◦ Atypical hemolytic uremic syndrome (aHUS) ◦ Neur
Slide 20: Complement C5 and ALN-CC5 Program
GENETIC MEDICINES Complement C5 and ALN-CC5 Program Alternative Pathway Classical Pathway Lectin Pathway Initiation C3 C1 Complement C5 is genetically validated target C3 C4 and C2 • Key component of terminal pathway C3 Convertase Factor B ◦ C5 cleavage releases C5a; initiates C3bBb C4bC2a membrane
Slide 21: ALN-CC5 Pre-Clinical Data in NHP
GENETIC MEDICINES ALN-CC5 Pre-Clinical Data in NHP Comparison of Single Dose and Multi-Dose Data Single Dose Serum C5 Hemolysis 1-20 20 1-20 20 % H e m o ly s is r e d u c t io n 1 000 1 000 % C 5 knockdow n 80 20 80 20 40 60 40 60 60 40 60 40 80 20 80 20 1000 1000 0 10 20 30 40 50 60 70 80 0 10 20
Slide 22: ALN-CC5 Phase 1/2 Study
GENETIC MEDICINES ALN-CC5 Phase 1/2 Study Dose-Escalation Study Including Patients with PNH PART A PART B PART Study Design C • Randomized, double- Study Design blind, placebo-controlled • Randomized, double- Study Design SAD study in healthy blind, placebo-controlled • Open-label MAD study in volun
Slide 23: ALN-CC5 Single Dose Phase 1/2 Study Results
GENETIC MEDICINES ALN-CC5 Single Dose Phase 1/2 Study Results Potent C5 Knockdown and Inhibition of Complement Activity C5 knockdown and complement inhibition with single dose ALN-CC5 • Potent, dose-dependent, and durable C5 knockdown up to 96% ◦ Mean maximum knockdown of 94 ± 2.0% (p <0.003 vs. pla
Slide 24: Acute Intermittent Porphyria (AIP) Program
GENETIC MEDICINES Acute Intermittent Porphyria (AIP) Program Unmet Need, Product Opportunity, and Program Status AIP is autosomal dominant disorder • Ultra-rare orphan disease ◦ ~5,000 Patients with annual attacks U.S./EU ◦ ~500 Patients with recurrent attacks U.S./EU High unmet need and cost • Pati
Slide 25: AAT Deficiency-Associated Liver Disease
GENETIC MEDICINES AAT Deficiency-Associated Liver Disease Unmet Need, Product Opportunity, and Program Status Alpha-1 liver disease is autosomal disorder • Commonest mutant allele (PiZZ) homozygosity results in liver cirrhosis • Z-AAT protein misfolds and aggregates in hepatocytes ◦ Leads to liver i
Slide 26: Genetic Medicine Partnership
GENETIC MEDICINES Genetic Medicine Partnership Global Commercialization for Value Creation CAMBRIDGE, MA Transformational alliance to expand and accelerate global product value • Includes Alnylam Genetic Medicine products that achieve human POC through end-2019 • $700M upfront investment; 12% Alnyla
Slide 27: Alnylam Development Pipeline
GENETIC MEDICINES Alnylam Development Pipeline Discovery Development Phase 1 Phase 2 Phase 3 GENETIC MEDICINES Patisiran (ALN-TTR02) TTR-Mediated Amyloidosis Revusiran (ALN-TTRsc) Hemophilia and Rare Bleeding Disorders ALN-AT3 Complement-Mediated Diseases ALN-CC5 Hepatic Porphyrias ALN-AS1 Alpha-1 A
Slide 28: PCSK9 and ALN-PCSsc Program
CARDIO-METABOLIC DISEASE PCSK9 and ALN-PCSsc Program Unmet need in hypercholesterolemia • Elevated LDL-C validated risk factor for coronary heart disease (CHD) • 34 million Americans have hypercholesterolemia (> 240 mg/dL) • Recent clinical studies ◦ Many patients on statins do not meet LDL-C goal ◦
Slide 29: ALN-PCSsc Pre-Clinical Efficacy
CARDIO-METABOLIC DISEASE ALN-PCSsc Pre-Clinical Efficacy Potent PCSK9 Knockdown and LDL-C Lowering Highly durable PCSK9 knockdown and LDL-C reduction • Single dose in NHP • Up to 96% PCSK9 knockdown, up to 77% LDL-C lowering; absence of statins • Highly durable effects, supports once-monthly or poss
Slide 30: ALN-PCSsc Phase 1 Study
CARDIO-METABOLIC DISEASE ALN-PCSsc Phase 1 Study Study Design • Randomized, single-blind, placebo-controlled, single ascending dose (SAD) and multi-dose (MD), subcutaneous dose-escalation study ◦ 3:1, ALN-PCSsc vs. placebo • Up to 76 volunteer subjects with elevated baseline LDL-C (≥100 mg/dL) ◦ MD
Slide 31: Alnylam Development Pipeline
CARDIO-METABOLIC Alnylam Development Pipeline DISEASE Discovery Development Phase 1 Phase 2 Phase 3 GENETIC MEDICINES Patisiran (ALN-TTR02) TTR-Mediated Amyloidosis Revusiran (ALN-TTRsc) Hemophilia and Rare Bleeding Disorders ALN-AT3 Complement-Mediated Diseases ALN-CC5 Hepatic Porphyrias ALN-AS1 Al
Slide 32: Hepatitis B Virus (HBV) Infection
HEPATIC INFECTIOUS DISEASE Hepatitis B Virus (HBV) Infection Chronic HBV (CHB) infection is significant WW problem • One third of world population infected • 400M people with chronic disease ◦ 25M in U.S./EU • Most unaware of infection • High prevalence expected for next 3 decades ◦ Despite availabi
Slide 33: RNAi Therapeutics for HBV: Efficacy in HBV-Infected Chimpanzees
HEPATIC INFECTIOUS DISEASE RNAi Therapeutics for HBV Efficacy in HBV-Infected Chimpanzees Dose-dependent antiviral response with intra-subject ascending doses • Mean 2.9 log10 decrease in viral DNA day 2-6 post 0.5 mg/kg dose ◦ >4 log10 reduction in circulating viral DNA achieved in highest titer an
Slide 34: ALN-HBV Development Candidate (DC)
HEPATIC INFECTIOUS DISEASE ALN-HBV Development Candidate (DC) Potent ESC-GalNAc-Conjugate for SC Administration Potent, multi-log HBsAg knockdown in murine model • Mouse model with AAV-HBV vector • ALN-HBV DC achieves potent knockdown of HBsAg ◦ Single SC dose of siRNA at 3 mg/kg; specificity confir
Slide 35: Guidance and Goals
Guidance and Goals HARMACEUTICALS
Slide 36: Alnylam STArs: Marketed Products and Clinical Programs
ZL Alnylam. 3 STArs 3 Marketed Products 10 Clinical Programs 4 Late Stage Programs
Slide 37: Alnylam 2015 Pipeline Goals
Alnylam 2015 Pipeline Goals 2015 * Early is Q1-Q2, Mid is Q2-Q3, and Late is Q3-Q4; **IND or IND equivalent Early Mid Late Ongoing APOLLO Phase 3 Accrual PATISIRAN Phase 2 OLE data (TTR-FAP) Start Phase 3 OLE ENDEAVOUR Phase 3 Accrual REVUSIRAN Phase 2 OLE Data (TTR-FAC) Natural History Results Phas
Slide 38: Select Scientific and Clinical Meetings
Select Scientific and Clinical Meetings Mid-’15 AAT Digestive Disease Week (DDW) May 16-19 (Washington DC) CC5 European Hematology Association (EHA) June 11-14 (Vienna) International Society of Thrombosis AT3 June 20-25 (Toronto) and Haemostasis (ISTH) August 29-September 2 PCSsc European Society of
Slide 39: Financial Summary and Guidance
Financial Summary and Guidance 2015 Q1 Financial Results • Cash ~$1.45B • GAAP Revenues $18.5M • Total GAAP Operating Expenses $70.7M ◦ Research and Development Expense $58.0M ◦ General and Administrative Expense $12.7M • GAAP Net Loss of $50.8M • Shares Outstanding ~84.2M 2015 Guidance • Year-end c
Slide 40: Thank You
Thank You www.alnylam.com 40
Alnylam Pharmaceuticals — Investor Presentation (June 2015) on 6ix